Definition of Ecotropic. Meaning of Ecotropic. Synonyms of Ecotropic

- Ecotropism or ecotropic (from eco – hearth and tropic – to turn towards) refers to the philosophy that for human culture to be healthy, it must exist...
- Cbl (named after Casitas B-lineage Lymphoma) is a mammalian gene family. CBL gene, a part of the Cbl family, encodes the protein CBL which is an E3 ubiquitin-protein...
- TACTGCTTTTGGTGTCATATCTAAG + Sine oculis homeobox homolog 4 CTTTTGGTGTCATAT + Ecotropic viral integration site 1 encoded factor, amino-terminal zinc finger domain...
- their envelope region. The ecotropic MLVs (from Gr.eco, "Home") are capable of infecting mouse cells in culture. Non-ecotropic MLVs may be xenotropic (from...
- and Uraniidae (moths). Checklist Reserva Biológica San Francisco (Prov. Zamora-Chinchipe, S. Ecuador)". Ecotropical Monographs (4) pp. 155–214. v t e...
- (1p36) EPS15 (1p32) ESPN: espin (autosomal recessive deafness 36) EVI5: ecotropic viral integration site 5 EXO5: encoding protein Exonuclease 5 EXTL1: exostosin...
- infect a wide range of hosts and tissues are said to be amphotropic. Ecotropic pathogens, on the other hand, are only capable of infecting a narrow range...
- MDS1 and EVI1 complex locus protein EVI1 (MECOM) also known as ecotropic virus integration site 1 protein homolog (EVI-1) or positive regulatory domain...
- EVI5L (Ecotropic Viral Integration Site 5-Like) is a protein that in humans is encoded by the EVI5L gene. EVI5L is a member of the Ras superfamily of...
- Goff SP, Arriagada G (August 2016). "Dynein Regulators Are Important for Ecotropic Murine Leukemia Virus Infection". Journal of Virology. 90 (15): 6896–6905...