- genetics, a
subclade is a
subgroup of a haplogroup.
Although human mitochondrial DNA (mtDNA) and Y
chromosome DNA (Y-DNA)
haplogroups and
subclades are named...
- Look up
subclade in Wiktionary, the free dictionary.
Subclade may be
Subclade, any
taxonomic clade which is
subordinate to
hierarchically higher clades...
- (R-M479).
Males carrying R-M173 in
modern po****tions
appear to
comprise two
subclades: R1a and R1b,
which are
found mainly in po****tions
native to Eurasia...
-
South Asia. Some
subclades of
haplogroup U have a more
specific geographic range.
Subclades are
labelled U1–U9;
Haplogroup K is a
subclade of U8. Van Oven...
-
tccaatctcaattcatgcctc In Y
chromosome phylogenetics,
subclades are the
branches of a haplogroup.
These subclades are also
defined by single-nucleotide polymorphisms...
- Asia, and
North Africa. The most
commonly occurring subclades are G1* (M285) and many
subclades of G2 (G-P287), especially: G2a (P15), G2a1 (G-FGC7535...
-
Balts and East
Slavs have the same
subclades and
similar frequencies in a more
detailed phylogeny of the
subclades. The
Russian geneticist Oleg Balanovsky...
- with all
known subclades as of June 2015. It
contains the E-V1515
clade defined by
Trombetta et al. 2015, and all the E1b1b
subclades distributed below...
- two
primary branches: R1b1-L754 and R1b2-PH155. R1b1-L754 has two
major subclades: R1b1a1b-M269,
which predominates in
Western Europe, and R1b1b-V88, which...
-
known subclades,
which are
haplogroup E-P2 and
haplogroup E-P75.
Haplogroup E-P2 is a
subclade of
haplogroup E-P177.
Haplogroup E-P75 is a
subclade of haplogroup...